X بستن تبلیغات
X بستن تبلیغات
header
متن مورد نظر

داروین

- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

 برای مخالفت با نظریه داروین علاوه برزیست شناسها، بزرگان ادیان و اکثر فقها چه مسلمان و چه مسیحی چه یهود وچه زردشتی کتابهای مختلفی نوشتند.طبق این نظریه شما از میمونهای تکامل یافته زاده شده اید یعنی انسان طی یک حوادث زیست شناسانه میمون شده انسان و کلا وجود حضرت آدم یا جدی بزرگ که خداوند با معجزه ای بزرگ آنرا آفرید را نفی میکند.

آقای قرائتی را که می شناسید همان روحانی که گاها تلوزیون او را نشان می دهد و رییس نهضت سواد آموزی است چندین سال پیش گفت:« اگه کسی گفت نظریه داروین درسته شما بگین من فرزند یک پیامبر هستم اما تو از اولاد یک میمونی همین برای او کافی هست

<!–[if !mso]> <!–[endif] –><!–[if gte mso 9]> Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 <!–[if gte mso 9]> <!–[if gte mso 10]> <!–[endif] –>

  \”داروین\”

 برای مخالفت با نظریه داروین علاوه برزیست شناسها، بزرگان ادیان و اکثر فقها چه مسلمان و چه مسیحی چه یهود وچه زردشتی کتابهای مختلفی نوشتند.طبق این نظریه شما از میمونهای تکامل یافته زاده شده اید یعنی انسان طی یک حوادث زیست شناسانه میمون شده انسان و کلا وجود حضرت آدم یا جدی بزرگ که خداوند با معجزه ای بزرگ آنرا آفرید را نفی میکند.

آقای قرائتی را که می شناسید همان روحانی که گاها تلوزیون او را نشان می دهد و رییس نهضت سواد آموزی است چندین سال پیش گفت:« اگه کسی گفت نظریه داروین درسته شما بگین من فرزند یک پیامبر هستم اما تو از اولاد یک میمونی همین برای او کافی هست»

الان این بحث کاملا رد شده تشریف داره اما متاسفانه تو ایران کمترزیست شناسا میگن غلطه اما خوشبختانه فقها و رجال دینی به این مهم اشاره دارند

تکامل چیست؟

اغلب میزان دانشی که بسیاری از افراد در مورد نظریه تکامل دارند این است که این نظریه میگوید انسانها قبلا میمون بوده اند و این چیزی است که مذهبیون و آخوند ها سعی دارند از تکامل نشان بدهند تا حتی کسی به فکر مطالعه این که تکامل چیست نیافتند.

این دسته افراد حتی گاهی بیشرمانه، یا از روی نادانی تکامل را بجای تئوری، فرضیه و یا نظریه مینامند و از روزنامه ها و تریبون های نظام آقا امام زمان تقریبا هفته ای یکبار اخباری مبنی بر زیر سوال رفتن این تئوری پخش میشود. شرح تئوری تکامل نیازمند نوشتن هزاران صفحه کتاب است، تئوری تکامل چیزی نیست که بتوان در یک مقاله آنرا توضیح داد، اگر به هر یک از دانشگاه های معتبر جهان مراجعه کنید خواهید دید که در بخش بیولوژی کتابخانه آن چندین قفسه به شرح پدیده تکامل اختصاص یافته است که هرکدام تنها قسمت کوچکی از موضوعات مربوط به تکامل را شرح میدهند.  پیچیده بودن پدیده تکامل باعث سوء استفاده مذهبیون میشود و آنها مردم عوام را گول میزنند که آخر چگونه ممکن است موجودات به یکدیگر تبدیل شوند وو به سادگی آنها را گول میزنند که مارا خدا آفریده!

تئوری تکامل امروز کامل ترین تئوری ای است که جامعه علمی جهان در مورد نحوه شکل گیری حیات و ادامه آن تا به امروز دارد. بسیاری از افراد فکر میکنند تکامل همان چیزی است که داروین کشف کرده است در حالی که داروین در تاریخ تکامل سومین شخصی است که بطور علمی و دقیق به بررسی این تئوری میپردازد و تکامل امروز با آنچه داروین کشف کرده بود بسیار متفاوت است.

داروین با بررسی آناتومی استخوان بدن جانورانی که جمع آوری کرده بود به این نتیجه رسید که شباهت بسیار زیادی در طرز شکل گیری این ساختمانها وجود دارد و در مورد انسان اعلام کرد که آناتومی بدن انسان با آناتومی بدن بوزینه (و نه میمون، ساختمان بدن میمون و گوریل و شامپانزه و بوزینه علی رغم تشابه ظاهری بسیار متفاوت است) بسیار شبیه است و نتیجه گرفت که انسان و بوزینه از یک تیره و از یک منشا تکاملی هستند (نه اینکه انسان قبلا بوزینه بوده است). داروین حدود ۲۰ سال از انتشار تئوری خود، خودداری کرد و بعد از تحقیقات بسیار آنرا انتشار داد.

فسیلهای باقیمانده از اجداد انسانها به خوبی نشان میدهد که ساختار بدن آنها با بدن انسانهای امروزی بسیار متفاوت بوده است، اکتشافات در این مورد بسیار گسترده بوده است و شاید آخرین آنها کشف آدمها با ساختمان بدنی کوچکتر و جمجمه کوچکتر اشاره کرد که در اکتبر ۲۰۰۴ در جزیره فلورز یافت شد (منبع خبر +) اما امروز بالاخره با دیگر نیازی به پیدا کردن استخوان ها و فسیل ها برای اثبات تئوری تکامل وجود ندارد، پیشرفت علوم مارا برای بررسی تکامل از یافتن فسیل ها و باقیمانده های جانوران تقریباً بی نیاز میکنند، هرچند گنجینه بسیار غنی از فسیلها امروز از لحاظ شهودی نیز راه را برای مشاهده تکامل جانوران بسیار آسان میکند.

ژنتیک که امروز بسیار گسترده و پیچیده و توسعه یافته شده است تکامل را بطور مشخص و دقیق اثبات و بررسی میکند و به عبارتی ژنتیک پایه تکامل است، یعنی بهترین توضیحات و توجیهات را برای بررسی موضوعات مختلف در ارتباط با تکامل را میتوان از دیدگاه ژنتیکی دریافت کرد. اطلاعات ژنتیکی که دستورالعمل های ساخت سلول هستند را امروز میتوان در هر موجودی مانند یک کتاب باز کرد و خواند. و همین تحقیقات ژنتیکی امروز نشان میدهد که ۹۹% ژنهای انسان و بوزینه کاملا مشترک هستند و تفاوت میان انسانها و بوزینه ها در همان ۱% است که باهم اختلاف دارند، بنابر این تحقیقات امروزی هم تئوری داروین را که با بررسی و مشاهده استخوانهای جانوران توسعه یافته بود، تایید میکنند. برای توضیح بیشتر در این مورد ابتدا باید اندکی با DNA آشنا شویم. در مورد DNA بطور مفصل در نوشته ای با فرنام (بنیاد و شالوده حیات، حیات چگونه آغاز میشود ؟) توضیحات کافی داده شده است و در اینجا تنها بطور مختصر در مورد آن توضیحاتی داده خواهد شد.

DNA یک مولکول بلند است که از زنجیره ای از واحدهای کوچکتر بیوپولیمر (واحدهای مرکبی که در سلول های زنده پیدا میشوند، مانند پروتئین ها، اسید نوکلئید ها و یا کربوهیدراتها ) تشکیل شده اند. اگر تمام DNA های انسان در کنار هم قرار گیرند و انتهایشان به ابتدای دیگری متصل شود رشته ای به طول تقریبی ۱۷۵ سانتیمتر زخامتی کمتر از یک میلیونیم سانتیمتر حاصل میشود. اگر زخامت و طول این رشته را بصورت متناسب به زخامت یک رشته سیم ویولون افزایش دهیم، طول رشته به حدود ۹ مایل خواهد رسید. در درون سلول این مولکولهای بلند دو به دو با هم پیچ میخورند و یک RNA را تشکیل میدهند. این رشته ها بوسیله پیوند هایی شیمیایی ای متشکل از فسفر و نوعی قند که بین این دو رشته وجود دارد به هم پیوسته میشوند. این پیوندها در واقع از یک بدنه و یک پایه تشکیل شده اند،  دو نوع پایه در این پیوند ها وجود دارد که پورین و پریمیدین نامیده میشوند. هر کدام از این دو نوع پایه خود دو نوع دیگر دارند، این نوع ها با توجه به نوع مواد شیمیایی بکار رفته در آنها دسته بندی شده اند.

·         پورین ها (Purines) خود به  دو دسته دیگر تقسیم میشوند:

۱.آدنین (Adenine) که با حرف A نمایش داده میشوند.

۲٫ گانین  (Guanine) که با حرف G نمایش داده میشوند.

·         و پریمیدین ها (Pyrimidines) نیز خود به دو دسته دیگر تقسیم میشوند:

۳٫ تیمین (Thymine) که با حرف T نمایش داده میشوند.

۴٫ سیتوزین (Cytosine) که با حرف C نمایش داده میشوند.

بنابر این ما ۴ نوع پایه داریم که اینها یک سیستم عددی مبنای ۴ را برای تبادل اطلاعات بین مولکول ها را بر عهده دارند.  بنابر این اطلاعات DNA یک موجود را میتوان همچون رشته ای از اطلاعات صفر و یک کامپیوتری (مبنای دو که تمام دستگاه های دیجیتال از آن استفاده میکنند) هموچن کتابی خواند، با این اختلاف که البای  DNA تنها از ۴ حرف تشکیل شده است. بعنوان مثال رشته زیر را میتوان حاوی اطلاعاتی دانست که از سلولی به سلول دیگر منتقل شده است.

 

ATAATTCGTTCAAGGGCTATATGCCGTTTAAAACGT

واحد های تولید کننده و نوع مواد تشکیل دهنده DNA در تمامی موجودات روی کره زمین (به استثنای چند ویروس که مواد دیگری DNA آنها را تشکیل میدهد) مشترک و دقیقا شبیه یکدیگر هستند. این موضوع خود نشان میدهد که تمامی این DNA ها ریشه های مشترک دارند و از یک جا برخاسته اند و ازDNA اولیه ای که شکل گرفته است مشتق شده اند. اما بطور مشخص و واضحی اطلاعات DNA یک انسان سیاه پوست با یک انسان سفید پوست تفاوت هایی دارد و میان DNA یک انسان با یک گیاه تفاوت های بسیار بیشتری وجود دارد و یا اطلاعات میان DNA یک انسان و یک بوزینه ۹۹% مشابه یکدیگر است. و البته میان DNA افرادی که از یک خانواده هستند تفاوت اطلاعات بسیار ناچیز تر است از تفاوت DNA بین دو غریبه. میان DNA زن و مرد نیز تفاوت هایی وجود دارد.

DNA در واقع دستور العمل های مهندسی ای را داراست که دستور العمل ساخت سلول را به مهندس های موجودات زنده یعنی پروتئین ها منتقل میکند و پروتئین ها با دقت تمام این دستور العمل ها را پیاده میکنند و نتیجه یک سلول با فعالیت دقیقاً مشخص و با ظرافت تمام است. همانطور که نوشته های البای مبنای ۳۲ زبان فارسی از نقطه ها و کلمات و فاصله ها تشکیل شده است، الفبای مبنای ۴ ژنتیکی نیز از حالت مشابهی پیروی میکنند.

همانطور که گفته شد DNA ها خود نیز از پروتئین های کوچکتری به نام آمینو اسید ساخته شده اند و تعداد کل انواع آمینو اسید ها در سلولهای بدن ۲۰ نوع است. در یک زبان مبنای ۴ برای نامیدن هرکدام از این ۲۰ نوع آمینو اسید تنها ۳ حرف نیاز است و ۶۴  (4 * 4 * 4) کلمه ۳ حرفی مختلف را میتوان با استفاده از الفبای ۴ حرفی ژنتیکی تشکیل داد. اما در موجودات زنده تنها از ۱۶ نوع کلمه سه حرفی متشکل از این حروف الفبای مبنای ۴ استفاده میشود که به هر کدام اصطلاحا کودون (Codon) میگویند. شکل زیر این مفهوم را به تصویر کشیده است.هر کدام از این کودون ها معنی مشخصی دارند و همه آنها امروز شناخته شده اند و معانی آنها نیز تفسیر شده است. بعضی از این کودون ها نقش آغاز و پایان یک پیغام ژنتیکی را بازی میکنند. شکل این پایه ها بگونه ای است که تنها میتوانند با پایه مشخصی توسط پیوند های هیدروژنی ترکیب شوند و ارتباط برقرار کنند، مثلا هروقت در یک شاخه A وجود داشته باشد، حتماً باید در طرف دیگر T وجود داشته باشد. پیوستن A با C مانند این است که کسی تلاش کند یک پریز را که سه سوراخ دارد با یک دوشاخه وصل کند، این اتفاق غیر ممکن نیست اما بسیار دشوار است و بسیار کم اتفاق می افتد.

A با T پیوند میخورد

C با G پیوند میخورد


این است که در واقع وقتی سلولی میخواهد تکثیر شود، در بین دو رشته ای که اطلاعات DNA آنرا تشکیل میدهند شکافی ایجاد میشود. چون A تنها با T و C تنها با G ارتباط برقرار میکند، این دو رشته از هم شکافته شده دقیقا اطلاعات مشترکی را حمل میکنند و مانند این است که قرینه یکدیگر باشند، بعد ازجدا شدن این دو شاخه وقتی DNA جدید درون فضایی پر از انواع و اقسام آمینو اسید ها قرار میگیرد به سرعت جفت های خود را جذب میکند، و دوباره به یک شکل نردبان پیچ خورده تبدیل میشود و در این پروسه است که دستور العمل های ساخت سلول از سلولی به سلول دیگر منتقل میشوند. اطلاعات ترتیب یافته به سبک اطلاعات ژنتیکی در واقع حاوی تمام مشخصات موجود جدیدی است که باید شکل گیرد، این اطلاعات در میان تمام جانوران از والد به فرزند انتقال می یابند.

 همانطور که اشاره شد، بسیاری از افراد چون اطلاعی از تئوری تکامل ندارند و یا چون آنرا درک نمیکنند و تحت تاثیر تبلیغات مذهبی قرار دارند، ترجیح میدهند بجای قبول کردن توضیحات دقیق و مشخص علمی، تصور کنند که خدایی وجود دارد و زمین را از موجودات مشخصی آکنده کرده و انسان را در آن در جایگاهیی بالاتر و والاتر قرار داده است، این درحالی است که حدود ۳۳۵ میلیون سال پیش، اتفاقاتی افتاد که موجب نابودی کامل ۹۶% تمامی موجودات روی زمین شد و تمامی موجودات باقیمانده از آن ۴% باقیمانده گونه های جانوری تکامل یافته اند. این تنها یکی از این نوع اتفاقها بوده است، دانشمندان معتقدند تعداد گونه های جانوری که امروز روی زمین موجود هستند کمتر از یک دهم ۱% تمام گونه های جانوری است که تابحال روی زمین زیسته اند. به داستانهای افسانه ای که سعی میکنند آفرینش بشر و جانوران را توجیه کنند (مثل قصه آدم و حوا) امروزه تنها میتوان بعنوان \”افسانه های آفرینش\” نگاه کرد. این قصه های آفرینش تقریباً در تمام ادبیات ملل و فرهنگ های مختلف وجود دارد. قبایلی تمساح پرست در آفریقا اعتقاد داشتند که ماه و خورشید باهم ازدواج کرده اند و تمساح را پدید آورده اند و تمساح آدم را آفرید و… هندو ها خدایی با مسئولیت خلق حیات دارند که معتقد هستند روی زمین آمده است و جانوران را خلق کرده است و خوب قصه آدم و حوا نیز از داستانهای ملل سامی بود که وارد یهودیت و بعد اسلام و مسیحیت و بهائیت شده است. متاسفانه عده زیادی از افراد نا آگاه این قصه ها و افسانه ها را جدی میگیرند و به آنها ایمان دارند (ایمان چیست؟) و چون ایمان منطق و علم را بر نمیتابد معمولا این افراد به لجبازی و بافتن دلایل غیر منطقی و مضحک علیه تئوری علمی و آزمایش شده و دقیق تکامل میپردازند.

بررسی تعدادی از ایرادهایی که دین خویان در مورد تکامل میگیرند:

تکامل تنها یک تئوری است و هنوز اثبات نشده است! این افراد نمیدانند که در دنیای علم هیچ مفهومی بالاتر از تئوری نمیرود و تئوری بالاترین مرحله ایست که یک نظر علمی میتواند داشته باشد. قوانین جاذبه نیوتون، قوانین حرکتی نیوتون، سرعت نور، رابطه فیثاغورس، بیگ بنگ، همه و همه چیزهایی که امروز بعنوان قوانین مطرح میشوند تنها تئوری هستند. در مورد این قضیه بطور مفصل در نوشتاری با فرنام (علم چیست؟) توضیح داده شده است.

چون تکامل مبتنی بر شانس است، و احتمال آن بسیار کم است، محال است که اتفاق بیافتنددرک این افراد از تصادف، شانس و احتمال غلط است و وقتی میگویند احتمال پایین محال است، از ابتدایی ترین اصول جبر و احتمال بیخبر هستند، در نوشتاری با فرنام \”مگر میشود همه چیز بطور تصادفی بوجود آمده باشد؟\” بطور مفصل در مورد این قضیه توضیح داده ایم.

تکامل نیاز به یک سلول اولیه دارد، تکامل از وقتی آغاز میشود که سلول اولیه ای وجود داشته باشد، آن سلول اولیه را باید خدا درست کرده باشد، حتی با پذیرش تکامل نمیتوان عدم وجود خدا را اثبات کرد، یک کسی باید موجودات را تکامل داده باشد آن کس خداست! تئوری تکامل به خودی خود یک تئوری برای اثبات عدم وجود خدا نیست، وجود و یا عدم وجود خدا مربوط به علوم نیست بلکه با فلسفه در ارتباط است (فلسفه چیست؟) و از لحاظ فلسفی تمامی تئوری های علمی اگناستیک هستند (اگناستیسزم، چیست؟) یعنی نه میتوانند وجود خدا را اثبات کنند نه میتوانند آنرا رد کنند. بلکه تنها میتوان از مفاهیم علمی در استدلال های منطقی و فلسفی انتزاع (و نه استنتاج) کرد و بعنوان مفاهیم شهودی از آنها استفاده کرد. اما این تنها در صورتی است که خدا (خداوند چیست؟) را بعنوان یک مفهوم بسیار کلی در نظر بگیریم، بسیاری از افراد اعتقاد دارند تئوری تکامل عدم وجود الله، یهوه و… را اثبات میکند. لازم به ذکر است داروین خود یک خداپرست بود و به اشتباه فکر میکرد موجود اولیه را باید خدایی درست کرده باشد که این ناشی از خطای فلسفی و نادانی از دانسته های امروز ژنتیک است که در آنروز داروین از آنها خبر نداشت. اما در مورد سلول اولیه و اینکه چگونه سلول اولیه و اولین واحد حیات میتواند بوجود بیاید، توضیحات علمی و مفصلی را در نوشتاری با فرنام (بنیاد و شالوده حیات، حیات چگونه آغاز میشود؟) بررسی کرده ایم و نشان داده ایم که روش بوجود آمدن اولین سلول را هم میتوان توضیح داد و اصلا نیازی به وجود خدا برای توضیح اولین سلول بوجود آمده در زمین نیست. در مورد تکامل هم هیچ نیازی به یک نیروی ماوراء طبیعی و یا به قول دینگرایان موجود متافیزیکی (متافیزیک چیست؟) وجود ندارد. ذهن دینگرایان معمولا همیشه به سمت \”اولین موجود\” و یا \”اولین ذره میرود\” این خطا را در نوشتاری با فرنام \”دلیل بیگ بنگ چه بوده است؟ اولین موجود رو کی آفرید؟ چرا یک چیز نمیتواند از ناچیز بوجود بیاید؟\”  توضیح و شرح داده شده است. همچنین توضیحاتی در مورد این روش رایج و غلط فکر کردن در \”برهان علیت و  برهان حرکت\” آورده شده است.

 

 

ارسال نظر